Protein Production
293FT, 293E, CHO

Truly Functional Protein
95% Purity
1-10 mg in 2 weeks

GeneExpressoMax™
293Expresso™

Transfection Reagents
* 90% Efficiency
* 95% Viability
* No sera interference
* Simple protocol
* High-throughput
* Only $98/ml

Baculovirus
Functional Protein
95% Purity
Fast turnaround
1-10 mg from Sf9 cells

Adenovirus, AAV
& Lentivirus

ORF or shRNA
* High Titer
* Cre, FLP, ΦC31
* Protein Kinases
* Transcription Factors
* Luciferases, GFP, RFP
* Protein Production
* Stable Cell Line


Excellgen

SuperFolder GFP

SuperFolder GFP (sfGFP) has
1, Cycle3 mutations: F99S, M153T, and V163A;
2, Enhanced GFP mutations: F64L and S65T;
3, Six additional mutations: S30R, Y39N, N105T, Y145F, I171V, A206V;
4, Q80R mutation

Characteristics of SuperFolder GFP:

1, 100% fluorescence recovery after denaturing by urea
2, Very bright
3, Faster chromophore formation

Sequence:

atgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggt
 M  R  K  G  E  E  L  F  T  G  V  V  P  I  L  V  E  L  D  G
gatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggt
 D  V  N  G  H  K  F  S  V  R  G  E  G  E  G  D  A  T  N  G
aaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctg
 K  L  T  L  K  F  I  C  T  T  G  K  L  P  V  P  W  P  T  L
gtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcag
 V  T  T  L  T  Y  G  V  Q  C  F  A  R  Y  P  D  H  M  K  Q
catgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttccttt
 H  D  F  F  K  S  A  M  P  E  G  Y  V  Q  E  R  T  I  S  F
aaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggta
 K  D  D  G  T  Y  K  T  R  A  E  V  K  F  E  G  D  T  L  V
aaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataag
 N  R  I  E  L  K  G  I  D  F  K  E  D  G  N  I  L  G  H  K
ctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggc
 L  E  Y  N  F  N  S  H  N  V  Y  I  T  A  D  K  Q  K  N  G
attaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgat
 I  K  A  N  F  K  I  R  H  N  V  E  D  G  S  V  Q  L  A  D
cactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactat
 H  Y  Q  Q  N  T  P  I  G  D  G  P  V  L  L  P  D  N  H  Y
ctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctg
 L  S  T  Q  S  V  L  S  K  D  P  N  E  K  R  D  H  M  V  L
ctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatga
 L  E  F  V  T  A  A  G  I  T  H  G  M  D  E  L  Y  K  -

Availability of SuperFolder GFP

1, Gene synthesis

2, From BioBrick

Promoter mut3 mut3 – 6his superfolder superfolder – 6his P7 P7 – his
pBAD (I0500) I13540; from registry I746902 I746908 I746914 I746904 I746905
T7 (I719005) I719015; from registry I746906 I746909 I746915 I746906 I746907

July 27, 2010 at 10:43 pm

Leave a Comment

*
To prove you're a person (not a spam script), type the security word shown in the picture. Click on the picture to hear an audio file of the word.
Click to hear an audio file of the anti-spam word


Sponsored Links Excellgen http://www.labsupplymall.com

Recombinant Lentivirus & Adenovirus
High Yield and High Titer up to 1010 (lentivirus) and 1013 (adenovirus) for Guaranteed Expression of GOI. $3000, $2500
Transient Protein Expression in CHO and HEK293 Cells
Transient Expression, Truly Functional Protein, 95% purity, 1~20 mg, fast turnaround. $5500, $3950
Baculovirus Protein Expression
Fast turn around, >95% purity functional protein. No outsourcing to China or India. $5500, $3950