CD8 signal peptide
ggatccagccaccatggccttaccagtgaccgccttgctcctgccgctggccttgctgctc
             M  A  L  P  V  T  A  L  L  L  P  L  A  L  L  L
cacgccgccaggccgaagcccaccgagaacaacgaagacttcaacatcgtggccgtggcc
 H  A  A  R  P  K  P  T  E  N  N  E  D  F  N  I  V  A  V  A
agcaacttcgcgaccacggatctcgatgctgaccgcgggaagttgcccggcaagaagctg
 S  N  F  A  T  T  D  L  D  A  D  R  G  K  L  P  G  K  K  L
ccgctggaggtgctcaaagagatggaagccaatgcccggaaagctggctgcaccaggggc
 P  L  E  V  L  K  E  M  E  A  N  A  R  K  A  G  C  T  R  G
tgtctgatctgcctgtcccacatcaagtgcacgcccaagatgaagaagttcatcccagga
 C  L  I  C  L  S  H  I  K  C  T  P  K  M  K  K  F  I  P  G
cgctgccacacctacgaaggcgacaaagagtccgcacagggcggcataggcgaggcgatc
 R  C  H  T  Y  E  G  D  K  E  S  A  Q  G  G  I  G  E  A  I
gtcgacattcctgagattcctgggttcaaggacttggagcccatggagcagttcatcgca
 V  D  I  P  E  I  P  G  F  K  D  L  E  P  M  E  Q  F  I  A
caggtcgatctgtgtgtggactgcacaactggctgcctcaaagggcttgccaacgtgcag
 Q  V  D  L  C  V  D  C  T  T  G  C  L  K  G  L  A  N  V  Q
tgttctgacctgctcaagaagtggctgccgcaacgctgtgcgacctttgccagcaagatc
 C  S  D  L  L  K  K  W  L  P  Q  R  C  A  T  F  A  S  K  I
                                       |---> CD8
cagggccaggtggacaagatcaagggggccggtggtgaccccaccacgacgccagcgccg
 Q  G  Q  V  D  K  I  K  G  A  G  G  D  P  T  T  T  P  A  P
cgaccaccaacaccggcgcccaccatcgcgtcgcagcccctgtccctgcgcccagaggcg
 R  P  P  T  P  A  P  T  I  A  S  Q  P  L  S  L  R  P  E  A
tgccggccagcggcggggggcgcagtgcacacgagggggctggacttcgcctgtgatatc
 C  R  P  A  A  G  G  A  V  H  T  R  G  L  D  F  A  C  D  I
tacatctgggcgcccttggccgggacttgtggggtccttctcctgtcactggttatcacc
 Y  I  W  A  P  L  A  G  T  C  G  V  L  L  L  S  L  V  I  T
ctttactgcaaccacaggaaccgaagataa
 L  Y  C  N  H  R  N  R  R  -  

LOCUS       NP_001139345/NM_001145873       235 aa
T-cell surface glycoprotein CD8 alpha chain isoform 1 precursor
        1 malpvtalll plalllhaar p
sqfrvspld rtwnlgetve lkcqvllsnp tsgcswlfqp
       61 rgaaasptfl lylsqnkpka aegldtqrfs gkrlgdtfvl tlsdfrrene gyyfcsalsn
      121 simyfshfvp vflpakpttt paprpptpap tiasqplslr peacrpaagg avhtrgldfa
      181 cdiyiwapla gtcgvlllsl vitlycnhrn rrrvckcprp vvksgdkpsl saryv
     CDS             1..235
                     /gene="CD8A"
                     /gene_synonym="CD8; Leu2; MAL; p32"
sig_peptide     1..21                      /calculated_mol_wt=2195
Site            183..203       /site_type="transmembrane region"

1. Seed the required number of gelatin-coated 24-well plates with γ-irradiated DR4 MEFs
2. Seed the colonies on the plates 1-2 hours before picking.
3. Add 15 μl of PBS to the wells of a V-bottomed 96-well dish.
4. Wash the dish containing the colonies to be picked once with PBS and add 10ml of PBS to the dish.
5. Pick the colonies with the small 5μl pipet tips (set the P20 pipetman on 4 μl). Transfer colonies to a well in the 96-well dish.
6. Add 20 μl of trypsin to each well using the multi-channel (12) pipetor. Pipet up and down 3 times. Incubate at 37°C for 4 minutes.
7. Add 100 μl of ES medium to the trypsinized colonies. Pipet up and down 10 times. Transfer 6 clones at a time from the 96-well dish to a 24-well dish using a tip at every other position on the 12 place pipetor.
8. Grow the cells on the 24-well plate in a 37°C, 5% CO₂ incubator until the cells reach 80–90% confluency, feeding daily with ES cell medium. Cells will probably be ready to expand in 3-7 days.

IV Expansion of iPS cells and make cell stocks

1. Aspirate the medium, and wash the cells with 1 ml of PBS.
2. Remove PBS completely, add 0.1 ml of 0.25% trypsin/1 mM EDTA and incubate at 37°C for 10 min.
3. Add 0.4 ml of the ES medium and suspend the cells by pipetting up and down to single cell suspension.
4. Transfer the cell suspension to a well of 6-well plate, add 1.5 ml ES cell medium, and incubate in a 37°C, 5% CO₂ incubator until cells reach 80–90% confluency in 6-well plates. At this point, prepare frozen stock of the cells, as follows.
5. Aspirate the medium, and wash the cells with 2 ml of PBS.
6. Remove PBS completely, add 0.5 ml of 0.25% trypsin/1 mM EDTA and incubate at 37°C for 10 min.
7. Add 2 ml of the ES medium and suspend the cells by pipetting up and down to single cell suspension.
8. Transfer the cell suspension to a 15-ml tube, count the number of cells and spin down the cells.
9. Discard the supernatant, resuspend the cells with ES medium to the concentration at 2×10⁶ cells per ml.
10. Prepare 2 ES cell freezing medium (20% DMSO in ES medium) and aliquot it at 0.5 ml per vial.
11. Transfer 0.5 ml of the cell suspension to freeze vials and mix gently.
12. Put the vials in a cell-freezing container and keep it at -80°C overnight; transfer to liquid nitrogen the next day for long-term storage.

1. Preparation of solutions and materials for dissection and maintenance of neural stem cell culture

Prepare 100ml dissection medium (KNOCKOUT DMEM/F12, Invitogen) ahead of time and refrigerate.

Prepare cell-freezing medium (KNOCKOUT DMEM/F12+10%FBS+ 5%DMSO) for long term cryopreservation of cells.

Sterile, autoclaved forceps and scalpel blades with handles are used for dissection.

Set aside several 10 cm culture dishes (BD) for dissection, 50 ml centrifuge tubes (BD) for dissociation, 1.5 ml centrifuge tubes for tissue storage and frozen vials (BD) for freezing cells.

2. Isolating human neural stem cells from the human fetal brain

1. Harvesting of viable tissue immediately after termination of the fetus is vital to the success of the procedure. For elective procedures, timing to obtain samples can be arranged in advance so as to minimize time after fetal demise. The products of conception are harvested within 2 hours post procedure, but ideally can be achieved on elective procedures within minutes. The fetal tissues often are fragmented. However, in general a significant portion of the brain remains intact for visual identification. Limitations of gestational age (GA) are determined by statutory law but have been performed using this protocol between 18-22 weeks GA.
2. Fetal brain is placed in a 10 ml Petri dish containing ice-cold KNOCKOUT DMEM/F12 solution. Identify different parts of the cortex by anatomical landmarks. Boundaries for the frontal and parieto- occipital cortices are oriented by the extrapolated intersection of the central sulcus and sylvian fissure. Dissect tissue from the frontal cortex anterior to the central sulcus and along the border of the sylvian fissure with surgical blades, making sure to keep the ventricle intact and undamaged.
3. Remove any residual blood and meninges from the separated block of frontal cortex. If the sample is of sufficient quality, it is ideal to dissect the block into several smaller samples for various purposes: sections (fixed in 4% paraformaldehyde, PFA) and protein/mRNA assays (fast frozen in -80°C).
4. Transfer the selected brain block to a 50 ml centrifuge tube, and add ice-cold KNOCKOUT DMEM/F12 solution at about 3 times of the tissue’s volume. Gently dissociate the tissue by mechanical pipetting with a 10 ml transfer pipette until all the tissues becomes fragmented (generally 20-30 times), and then filter the cells through a 40 μM cell strainer (BD Falcon 352340) to obtain single or near single cell suspension.
5. Centrifuge the cell suspension at 2000 rpm and room temperature for 5 min, resuspend the cell pellet in 10 ml fresh warm culture medium (Stem Pro NSC SFM), and count the cell number with a hemocytometer.
6. Add 5 ml warm culture medium into each 25 cm² culture flasks, and transfer 2X10⁶ cells to each flask. Cultures are maintained in a 37°C/5% CO₂ incubator for 1 week before the analysis. Change half the medium once a week for further cultures or experiments.

3. Manipulaton of neural stem cells for further characterization or experimentations

1. Neurospheres usually form in 1 to 2 weeks under the recommended culture conditions with NSC diameter ranging between 200 and 400 μm. Neurospheres at this stage can be dissociated with 0.2 g/L EDTA in calcium and magnesium free Hanks medium (Hanks) at 37°C for 15 min to obtain single cells. Cells suspension are spun at 2000 rpm, rinsed in fresh Hanks, and replated in warm culture medium for subculture.
2. To initiate differentiation, dissociated cells are plated on poly-D-lysine/laminin 1 coated coverslips at a density of 1X10⁵ cells per coverslip (24mmX24mm). Oligodendrocyte differentiation is achieved by maintaining the cells in KNOCKOUT DMEM/F12 (Invitrogen, Main, MD)+2% B27(50X, Invitrogen, Main, MD)+10ng/ml bFGF+100ng/ml SHH+ 10ng/ml PDGF-AA for 2days, then switching to the same medium without growth factors for another 5 days. Neuronal differentiation is achieved by maintaining cells in KNOCKOUT DMEM/F12 +2% B27 (50X) for 7 days. Astrocyte differentiation is done by culturing cells in KNOCKOUT DMEM/F12 +1%FBS for a week.
3. Transfection of neural stem cells with genes can be done with dissociated cells from the preformed neurospheres. Here, we showed the neural stem cells transfected with EGFP-C1 by electroporation. The electroporation of EGFP-C1 construct was done using AMAXA Nucleofector Kits for Mouse Neural Stem Cells (VPG-1004) with AMAXA Nucleofector Device (Lonza AAD-1001), following the company’s instruction. In short, 5 μg DNA with 1 X 10⁶ cells were mixed with 100 μl transfection medium, and after pulse electroporation, the cells were resuspended in the neural stem cells maintaining medium for further culture. The differentiation of transfected cells were processed with the dissociation of neurospheres 3-4 days after the electroporation, following the same procedures described in step 3.2.

4. Freezing neural stem cells and subcultures

1. Dissociated cell suspensions are centrifuged and resuspended in freezing medium with a concentration of 1X10⁷ cells/vial/ml. Slowly freeze the cells in -20°C, -80°C then transfer to liquid nitrogen for long time storage.
2. The cells are fast thawed with 37°C water bath and resuspended in warmed DMEM/F12+10% serum for a wash, centrifuged to remove the freezing medium, and resuspended in the warmed culture medium.

1. One day before transfection, split 293T cells into new 100 x 20 mm tissue culture dishes at approximately 2 X 10^6 per plate and incubate at 37 °C.

2. Transfection

 On the following day, the  293T cells should be 80-95% confluent.  Label 1.5 ml polypropylene microfuge tubes for each plasmid DNA to be transfected, add 500 μl DMEM without serum to each tube.

 Add 10 μg plasmid DNA (Renilla luciferase-antigen fusion construct) to one tube.
 Add 30 μl of GeneExpresso Max to another tube.
 Add diluted GeneExpresso Max to diluted DNA
 Mix and then incubate the mixture for 15 minutes at room temperature.
 Transfer the DNA-GeneExpresso solution to the cells by dripping it evenly into the media of the 293T cells.

3. Harvest 293T cells two days after transfection

3.1. Remove culture media and  rinse cells gently with 6 ml of PBS. Remove residual PBS from the tissue culture dish.

3.2. Add 1.4 ml of cold lysis buffer composed of 50 mM Tris, pH 7.5, 100 mM NaCl, 5 mM MgCl2, 1% Triton X-100, 50% glycerol (optional) and protease inhibitors (2 tablets of complete miniprotease inhibitor cocktail per 50 ml of lysis buffer). Harvest cells with a cell scrapper and quickly transfer half of the lysate to each of two 1.5 ml microfuge tubes on ice.

3.3. Place the microcentrifuge tube containing the cell lysate on ice and sonicate the lysate using a sonicator. Alternatively, add DNase I to the lysate to digest genomic DNA.

3.4. Centrifuge the cell lysate at 12,500 RPM for two 4 minute spins at 4 ° C. After the first spin, gently invert the tubes to remove the loosely attached debris from the sidewall of the tube. After the second spin, carefully transfer the supernatant, without disrupting the pellet, from the two tubes to a new microfuge tube on ice.

3.5. Calculate the light units (LU) per μl of lysate. To measure the LU, dilute 1 μl of lysate with 8 μl of PBS in a new microfuge tube. Directly add 100 μl of 1X coelenterazine substrate to the diluted mixture and immediately measure luminescence in the tube using a tube luminometer (e.g., 20/20n Turner Scientific) with a 5 second read.

3.6.Store the Ruc-antigen lysate at -20° C for 1-2 days or store for longer period of times in aliquots at -80° C.

4. Preparing a Sera Master Plate

4.1.  Make a sera master plate by first adding 450 μl of buffer A (50 mM Tris, pH 7.5, 100 mM NaCl, 5 mM MgCl2, 1% Triton X-100) to each well of a 96-deep-well polypropylene microtiter plate. At this step, Phenol Red dye can also be included in buffer A (final concentration is 0.2 μg/ml in Buffer A) for monitoring  sera sample addition and other steps of the LIPS assay.

4.2. Add 50 μl of sera from each sample to the different wells containing 450 μl of buffer A. Note this is a 1:10 dilution of the sera in buffer A. Do not add sera to the last two wells of the master plate (use these two wells for the buffer blanks).

4.3. Incubate the master plate, for 1-2 hours on a rotator platform. Use adhesive plate sealer or Parafilm  to seal the wells after each use and store the plate at 4°C. The serum in the master plate is stable for at least 1 month or longer.

5.  Luciferase Immunoprecipitation Systems (LIPS) assay

5.1.Use polypropylene 96-shallow well microtiter plates for LIPS assay. Add 40 μl of buffer A to each well of the 96-well plate using an 8 channel micropipette.

5.2. Take 10 μl of diluted sera (1 μl sera equivalent) from the master plate and add it directly to each well of the working plate using an 8 channel micropipette.

5.3. Add 1 X 10^7 light units (LU) of Ruc-antigen extract  in 50 μl of buffer A.

5.4. Incubate the plate on a rotary shaker for 1 hour at room temperature.

5.5. During the incubation, add 5 or 7 μl of a 30% suspension of Ultralink protein A/G beads (Pierce Biotechnology, Rockford, IL) in PBS to the bottom of each well of a new 96 well filter HTS plate (Millipore, Bedford, MA).

5.6. After the 1 hour incubation, transfer the 100 μl Ruc-antigen antibody mixture to 96 well filter HTS plates containing the protein A/G beads using an 8 channel micropipette.
   
5.7. Incubate the 96-well filter plate on a rotary shaker for 1 hour at room temperature.

5.8. Wash the filter plate on a vacuum manifold. Each well is washed 8 times with 100 μl of Buffer A, followed by two times with 100 μl of PBS. This can be performed manually or with a robotic pipetting workstation.

6.  Measuring Luminescence and data analysis

6.1. A Berthold LB 960 Centro microplate luminometer can be used for determining luminescence in each well using a single injector. Once the machine is on, rinse the injector with distilled H2O using the injector wash cycle. Prepare coelenterazine substrate using a protocol in Promega Renilla substrate kit.

Typically 6 ml of 1X coelenterazine substrate mix (i.e. 60 μl coelenterazine stock plus 6 ml of 1X buffer) is prepared for priming the machine and running one full 96-well plate.

Before analyzing the plate, the Berthold LB 960 Centro microplate luminometer is primed with 1X coelenterazine substrate.
Open a program file containing the setting for injecting the substrate and reading the plate. For these measurements, 50 μl of coelenterazine substrate is injected, the plate is shaken for 2 sec, followed by a 5 sec read of luminescence.

A partial read of the plate can also be selected (under the read menu). Start the program, which initiates reading of the plate.

6.2. After the run, remove the microtiter filter plate promptly to prevent spillage in the luminometer.

6.3. Export the data generated with the MikroWin program into an Excel format for analysis.

QLIPS

Incubate diluted serum with cell extract and buffer for only 5 min and then incubated for another 5 min with the protein A/G beads. The plate was then washed and read on the luminometer. The total time required to process the samples was less than 15 min.

Four critical points will assure the success of a good viral stock: