Protein Production
293FT, 293E, CHO

Truly Functional Protein
95% Purity
1-10 mg in 2 weeks

GeneExpressoMax™
293Expresso™

Transfection Reagents
* 90% Efficiency
* 95% Viability
* No sera interference
* Simple protocol
* High-throughput
* Only $98/ml

Baculovirus
Functional Protein
95% Purity
Fast turnaround
1-10 mg from Sf9 cells

Adenovirus, AAV
& Lentivirus

ORF or shRNA
* High Titer
* Cre, FLP, ΦC31
* Protein Kinases
* Transcription Factors
* Luciferases, GFP, RFP
* Protein Production
* Stable Cell Line


Excellgen

Archive for January, 2011

Conjugation of peptide to KLH

A. Checking Peptide
Thiol Groups

Do this before thiol
coupling, either to KLH or to resin. Peptide thiol groups have a tendency
to get lost after synthesis.

  1. Make up 5 mM
    Ellman’s reagent (dithio-bis-2-nitrobenzoic acid) in 0.1M NaPi pH
    7.2.
  2. Weigh out about
    1 mg of peptide into a tared tube.
  3. Add 0.5 ml reagent.
    It should go bright yellow.
  4. Dilute the mixture
    1/50 in buffer. Read A412 against reagent at the same concentration.
  5. Calculate the
    apparent molecular weight of the peptide based on thiol groups, using
    a molar extinction coefficient of 14,000. Compare this to the expected
    molecular weight of the peptide. They should agree within a factor
    of three, with the apparent molecular weight usually higher. If the
    thiol concentration is anomalously low, i. e., the apparent molecular
    weight is very high, there may be something wrong with the peptide-
    anyway it probably will not couple well. You may need to regenerate
    the thiol groups by reducing the peptide with excess DTT and running
    a P2 column.

Make peptide conjugate for
two rabbits (five injections per rabbit)

  1. Weigh out 100mg
    of keyhole limpet hemocyanin (KLH). Dissolve in 2ml water. It generally
    takes about 4 hours to dissolve.
  2. Sonicate and vortex.  Dialyze against 2L of
    0.1M NaPhoshate pH 7.8 overnight. This will remove any contaminating
    thiols or amino compounds.
  3. Spin 10 minutes
    at full speed in microfuge to remove aggregates (pellet).
  4. Split the KLH
    into 2 aliqouts for -SH and -NH2 coupling.
  5. For -NH2 coupling,
    add 5mg peptide to one aliquot, followed by glutaraldehyde to 0.1%
    final. Add the peptide as a solid if it is soluble, otherwise from
    a 100 mg/ml stock in DMSO. Precipitation does not matter and often
    happens. After adding the glut, check the pH with pH paper, and adjust
    to 7.8 if necessary using NaOH. Incubate 8-12 hrs at 4 degrees, rotating
    gently.
  6. Add a tiny
    pinch of NaBH4 to kill remaining glut. Make sure the sample is in
    a large tube since it tends to fizz up. Incubate 8-12 hrs at 4 degrees.
    This is the glut conjugate.
  7. For the -SH coupling,
    warm the other aliquot of KLH to room temp. Add 1/9 th volume of Iodoacetic
    acid N-hydroxysuccinimide ester at 100mg/ml in DMSO. Make the DMSO
    stock fresh, and protect the iodoacetamide reagent from light. IAA-NHS ester can be purchased from Sigma.
  8. After 10 minutes
    at room temp the KLH will start to get a little cloudy. Load it onto
    a P-10 column equilibrated with 0.1M NaPhosphate pH 7.8. Make sure
    the column is at least 10 times the volume of the sample. Pool the
    KLH containing fractions by color (it will be sort of greyish green).
    Add 5mg of peptide to them, as in step 5 above. Incubate at least
    8 hrs at 4 degrees, rotating gently.
  9. Pool the coupled
    peptide from the two proceedures. Dilute to 5ml with 0.15M NaCl. If
    there is a precipitate, sonicate vigorously to break it up. Split
    the immunogen into 1 ml aliquots (each aliquot will immunize two rabbits)
    and freeze it.

Comments

January 30, 2011 at 3:16 pm ·

Cancer related genes

Set Size* Species Description URL Citation
Atlas 365 human “Genes: hybrid gene found in at least one cancer case, or gene amplification or homozygous deletion found in a significant subset of cases in a given cancer-type.” http://atlasgeneticsoncology.org Huret JL, Minor SL, Dorkeld F, Dessen P, Bernheim A.
Atlas of genetics and cytogenetics in oncology and haematology, an interactive
database.
Nucleic Acids Res. 2000 Jan 1;28(1):349-51.
Bushman 187 multiple

From Cold Spring Harbor Retroviruses Chapter on Oncogenes, an early version of the CIS database, a list from Dr. Tony Hunter, and misc. additions from the literature.

N/A N/A
CANgenes 189 human 189 common genes that were mutated at significant frequency in all tumors of human breast and colorectal cancers. http://www.sciencemag.org/…/1133427_som_tables.zip The consensus coding sequences of human breast and colorectal cancers.
Science. 2006 Oct 13;314(5797):268-74
CIS(RTCGD) 575 mouse “Retroviral insertional mutagenesis in mouse hematopoietic tumors”
Retroviral Tagged Cancer Gene Database (RTCGD)
“retroviral integration in more than one tumor (common integration sites, CISs)”
http://rtcgd.abcc.ncifcrf.gov Akagi K, Suzuki T, Stephens RM, Jenkins NA, Copeland NG.
RTCGD: retroviral tagged cancer gene database.
Nucleic Acids Res. 2004 Jan 1;32(Database issue):D523-7.
French Lymphoma 38 human A list of lymphoid-specific oncogenes compiled by Marina Cavazzana-Calvo and colleagues N/A N/A
Sanger 427 human Compilation from literature: “genes that are mutated and causally implicated in cancer development” http://www.sanger.ac.uk/genetics/CGP/Census/ Futreal PA, Coin L, Marshall M, Down T, Hubbard T, Wooster R, Rahman N,
Stratton MR.

A census of human cancer genes.
Nat Rev Cancer. 2004 Mar;4(3):177-83.

Waldman 521 human Cancer genes sorted by chromosomal locus, with links to OMIM http://cc.ucsf.edu/people/waldman/GENES/completechroms.html N/A

http://microb230.med.upenn.edu/protocols/oncogenes.html

Comments

January 30, 2011 at 12:31 pm ·

Multi-Analyte Profiling (MAP): biomarkers from Rules-Based Medicine

http://www.rulesbasedmedicine.com/

1. Adiponectin 2. Adrenocorticotropic Hormone
3. Agouti-Related Protein 4. Alpha-1-Antichymotrypsin
5. Alpha-1-Antitrypsin 6. Alpha-1-Microglobulin
7. Alpha-2-Macroglobulin 8. Alpha-Fetoprotein
9. Amphiregulin 10. Angiopoietin-2
11. Angiotensin-Converting Enzyme 12. Angiotensinogen
13. Apolipoprotein A-I 14. Apolipoprotein A-II
15. Apolipoprotein A-IV 16. Apolipoprotein B
17. Apolipoprotein C-I 18. Apolipoprotein C-III
19. Apolipoprotein D 20. Apolipoprotein E
21. Apolipoprotein H 22. Apolipoprotein(a)
23. AXL Receptor Tyrosine Kinase 24. B Lymphocyte Chemoattractant
25. Beta-2-Microglobulin 26. Betacellulin
27. Bone Morphogenetic Protein 6 28. Brain Natriuretic Peptide
29. Brain-Derived Neurotrophic Factor 30. C-Peptide
31. C-Reactive Protein 32. Calbindin
33. Calcitonin 34. Cancer Antigen 125
35. Cancer Antigen 19-9 36. Carcinoembryonic Antigen
37. CD 40 antigen 38. CD40 Ligand
39. CD5 40. Chemokine CC-4
41. Chromogranin-A 42. Ciliary Neurotrophic Factor
43. Clusterin 44. Complement C3
45. Complement Factor H 46. Connective Tissue Growth Factor
47. Cortisol 48. Creatine Kinase-MB
49. Cystatin-C 50. E-Selectin
51. EN-RAGE 52. Endothelin-1
53. Eotaxin-1 54. Eotaxin-3
55. Epidermal Growth Factor 56. Epidermal Growth Factor Receptor
57. Epiregulin 58. Epithelial-Derived Neutrophil-Activating Protein 78
59. Erythropoietin 60. Factor VII
61. Fas Ligand 62. FASLG Receptor
63. Fatty Acid-Binding Protein, heart 64. Ferritin
65. Fetuin-A 66. Fibrinogen
67. Fibroblast Growth Factor 4 68. Fibroblast Growth Factor basic
69. Follicle-Stimulating Hormone 70. Glucagon
71. Glucagon-like Peptide 1, total 72. Glutathione S-Transferase alpha
73. Granulocyte Colony-Stimulating Factor 74. Granulocyte-Macrophage Colony-Stimulating Factor
75. Growth Hormone 76. Growth-Regulated alpha protein
77. Haptoglobin 78. Heat Shock Protein 60
79. Heparin-Binding EGF-Like Growth Factor 80. Hepatocyte Growth Factor
81. Immunoglobulin A 82. Immunoglobulin E
83. Immunoglobulin M 84. Insulin
85. Insulin-like Growth Factor I 86. Insulin-like Growth Factor-Binding Protein 2
87. Intercellular Adhesion Molecule 1 88. Interferon gamma
89. Interferon gamma Induced Protein 10 90. Interleukin-1 alpha
91. Interleukin-1 beta 92. Interleukin-1 receptor antagonist
93. Interleukin-2 94. Interleukin-25
95. Interleukin-3 96. Interleukin-4
97. Interleukin-5 98. Interleukin-6
99. Interleukin-6 receptor 100. Interleukin-7
101. Interleukin-8 102. Interleukin-10
103. Interleukin-11 104. Interleukin-12 Subunit p40
105. Interleukin-12 Subunit p70 106. Interleukin-13
107. Interleukin-15 108. Interleukin-16
109. Kidney Injury Molecule-1 110. Lectin-Like Oxidized LDL Receptor 1
111. Leptin 112. Luteinizing Hormone
113. Lymphotactin 114. Macrophage Colony-Stimulating Factor 1
115. Macrophage Inflammatory Protein-1 alpha 116. Macrophage Inflammatory Protein-1 beta
117. Macrophage Inflammatory Protein-3 alpha 118. Macrophage Migration Inhibitory Factor
119. Macrophage-Derived Chemokine 120. Malondialdehyde-Modified Low-Density Lipoprotein
121. Matrix Metalloproteinase-1 122. Matrix Metalloproteinase-2
123. Matrix Metalloproteinase-3 124. Matrix Metalloproteinase-7
125. Matrix Metalloproteinase-9 126. Matrix Metalloproteinase-9, total
127. Matrix Metalloproteinase-10 128. Monocyte Chemotactic Protein 1
129. Monocyte Chemotactic Protein 2 130. Monocyte Chemotactic Protein 3
131. Monocyte Chemotactic Protein 4 132. Monokine Induced by Gamma Interferon
133. Myeloid Progenitor Inhibitory Factor 1 134. Myeloperoxidase
135. Myoglobin 136. Nerve Growth Factor beta
137. Neuronal Cell Adhesion Molecule 138. Neutrophil Gelatinase-Associated Lipocalin
139. Osteopontin 140. Pancreatic Polypeptide
141. Peptide YY 142. Placenta Growth Factor
143. Plasminogen Activator Inhibitor 1 144. Platelet-Derived Growth Factor BB
145. Pregnancy-Associated Plasma Protein A 146. Progesterone
147. Proinsulin, Intact 148. Proinsulin, Total
149. Prolactin 150. Prostate-Specific Antigen, Free
151. Prostatic Acid Phosphatase 152. Pulmonary and Activation-Regulated Chemokine
153. RANTES 154. Receptor for advanced glycosylation end products
155. Resistin 156. S100 calcium-binding protein B
157. Secretin 158. Serotransferrin
159. Serum Amyloid P-Component 160. Serum Glutamic Oxaloacetic Transaminase
161. Sex Hormone-Binding Globulin 162. Sortilin
163. Stem Cell Factor 164. Superoxide Dismutase 1, soluble
165. T Lymphocyte-Secreted Protein I-309 166. Tamm-Horsfall Urinary Glycoprotein
167. Tenascin-C 168. Testosterone, Total
169. Thrombomodulin 170. Thrombopoietin
171. Thrombospondin-1 172. Thymus-Expressed Chemokine
173. Thyroid-Stimulating Hormone 174. Thyroxine-Binding Globulin
175. Tissue Factor 176. Tissue Inhibitor of Metalloproteinases 1
177. TNF-Related Apoptosis-Inducing Ligand Receptor 3 178. Transforming Growth Factor alpha
179. Transforming Growth Factor beta-3 180. Transthyretin
181. Trefoil Factor 3 182. Tumor Necrosis Factor alpha
183. Tumor Necrosis Factor beta 184. Tumor Necrosis Factor Receptor-Like 2
185. Vascular Cell Adhesion Molecule-1 186. Vascular Endothelial Growth Factor
187. Vitamin K-Dependent Protein S 188. Vitronectin
189. von Willebrand Factor

Comments

January 29, 2011 at 10:36 pm ·

Cleaning and rehydration of Tosoh columns

REHYDRATION

Sometimes a column dries out unintentionally, either because the mobile phase ran out and air was pumped through the column or because the endfittings were not air-tight during long-term storage. This can happen to any column, stainless steel or glass, if the plugs are not tightened or if air inadvertently is pumped into the column during use. It is easier to detect dehydration in glass columns because the dry packing will appear to pull away from the the column walls. This condition can be remedied by using the following procedure:

1. Connect the column to your LC system in reverse flow direction.
2. Make sure not to connect the column to the detector during this procedure.
3. Pump a filtered mobile phase of 20% methanol in distilled, deionized through the column at half of the recommended maximum flow rate. Use 60% methanol in case of reversed phase columns.
4. Continue this procedure until you are confident that the column has been rehydrated. Rehydration can take several hours, depending on the column size.
5. Connect the column to your LC system in normal flow direction.
6. Equilibrate with your normal mobile phase.
7. Perform the recommended QC tests to ensure that the column is performing properly.

CLEANING

Occasionally, samples contain components that will irreversibly adsorb onto the packing material. When this occurs, it is time to clean your column. Generally, if one of the performance characteristics of your column changes by 10% or more, it is prudent to clean your column. These performance characteristics are:

1. Asymmetry Factor
2. Retention Time
3. Resolution
4. Theoretical Plates

You do not necessarily have to run a standard test probe to monitor your column. If you have a well-resolved peak, this can be used to check column performance as well. To use a sample component, you must establish baseline data when the column is new and performing well. After establishing that the column is performing properly, using standard test probes, calculate the asymmetry factor, theoretical plates and resolution of one or more of your sample components. Also note the retention time. This becomes your “baseline test mix” with which you can later compare.

When you clean the column, there are a few basic rules to follow. These rules apply regardless of what type of TSK-GEL column you are running.

1. Clean your column in the reverse flow direction. [Since the 'contamination' takes place first at the top of the column, it will have to travel a shorter distance to exit the column when you turn it upside down.]
2. Do not connect the column to the detector. [No need to have the 'dirt' get in contact with the detector cell.]
3. Run the column at half of the maximum recommended flow rate, taking special care to monitor the pressure as the cleaning solution may be of different viscosity than your normal mobile phase.
4. If you are cleaning with a high or low pH solution, make certain that the rest of your chromatographic system (pump, pump seals, injector, etc.) is compatible.
5. If multiple cleaning solutions must be used, always rinse the column between cleaning solutions with 3-5cv of Milli-Q or DI water.
6. If the cleaning solutions listed below do not improve the resolution of the column, then urea or non-ionic surfactant may be tried.

Cleaning Solutions

SW and SWxl
1. Turn the column in reverse flow direction and run at half the maximum flow rate.
2. Clean with 5 column volumes (CV) of 1M sodium chloride (pH-7.0)
3. Clean with 5CV of Milli-Q or DI water.
4. Clean with 5CV of 20% acetonitrile.
5. Clean with 5CV of Milli-Q or DI water.
6. Turn column in normal flow direction and equilibrate in mobile phase for at least 45 minutes.

PW and PWxl
1. Turn column in reverse flow direction and run at half the maximum flow rate.
2. Clean with 5 column volumes (CV) of 1M sodium chloride (pH-7.0)
3. Clean with 5CV of Milli-Q or DI water.
4. Clean with 5CV of 20% acetonitrile.
5. Clean with 5CV of Milli-Q or DI water.
6. Turn column in normal flow direction and equilibrate in mobile phase for at least 45 minutes.

Ion Exchange, SW Type
1. High concentration salt (e.g. 0.5M – 1.0M) of your normal run buffer
2. Buffered solutions at low pH (e.g. 2 – 3)
3. Water soluble organic (MeOH, ACN, EtOH,10% – 20%) in aqueous buffer
4. Urea (8M) or non-ionic surfactant in buffer solution.

Ion Exchange, PW Type
1. 0.1M – 0.2M NaOH
2. 20% – 40% aqueous acetic acid
3. Water soluble organic (MeOH, ACN, EtOH,10% – 20%) in aqueous buffer
4. Urea (8M) or non-ionic surfactant in buffer solution.

Hydrophobic Interaction
1. 0.1M – 0.2M NaOH
2. 20% – 40% aqueous acetic acid

Reversed Phase, SW Type
1. Acetonitrile or methanol
2. Gradient from 10% – 100% acetonitrile or methanol in 0.05% trifluoroacetic acid

Reversed Phase, PW Type
1. Acetonitrile or methanol
2. 0.1M – 0.2M NaOH
3. 20% – 40% aqueous acetic acid

Comments

January 3, 2011 at 12:16 pm ·

Rhopalosiphum padi virus internal ribosome entry site

Xho1
nnnnn ctcgag

1 GATAAAAGAACCTATAATCCCTTCGCACACCGCGTCACACCGCGCTATATGCTGCTCATT
61 AGGAATTACGGCTCCTTTTTTGTGGATACAATCTCTTGTATACGATATACTTATTGTTAA
121 TTTCATTGACCTTTACGCAATCCTGCGTAAATGCTGGTATAGGGTGTACTTCGGATTTCC
181 GAGCCTATATTGGTTTTGAAAGGACCTTTAAGTCCCTACTATACTACATTGTACTAGCGT
241 AGGCCACGTAGGCCCGTAAGATATTATAACTATTTTATTATATTTTATTCACCCCCCACA
301 TTAATCCCAGTTAAAGCTTTATAACTATAAGTAAGCCGTGCCGAAACGTTAATCGGTCGC
361 TAGTTGCGTAACAACTGTTAGTTTAATTTTCCAAAATTTATTTTTCACAATTTTTAGTTA
421 AGATTTTAGCTTGCCTTAAGCAGTCTTTATATCTTCTGTATATTATTTTAAAGTTTATAG
481 GAGCAAAGTTCGCTTTACTCGCAATAGCTATTTTATTTATTTTAGGAATATTATCACCTC
541 GTAATTATTTAATTATAACATTAGCTTTATCTATTTATAATGTCTACGATGTCTTGCACC
601 AATTTACCAAAGTCAGTTCAACGC

Sph1
GCATGC nnnnn

Comments

January 2, 2011 at 10:05 pm ·